Recombinant:Article Title: CRISPRi-based screens in iAssembloids to elucidate neuron-glia interactions.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD133 MicroBead Kit, human Miltenyi Biotec Cat. No. 130-097-049; RRID: AB_3674474 Neural Crest Stem Cell MicroBeads, human Miltenyi Biotec Cat. No. 130-097-127; RRID: AB_3674475 Rabbit anti-NESTIN Abcam Cat. No. ab92391; RRID:AB_10561437 Rabbit anti-SOX2 Abcam Cat. No. ab97959; RRID:AB_2341193 Mouse anti-S100b MilliporeSigma Cat. No. S2532; RRID:AB_477499 Rabbit anti-NFIA MilliporeSigma Cat. No. HPA008884; RRID:AB_1854421 Rabbit anti-IBA1 FUJIFILM Wako Cat. No. 019-19741; RRID:AB_839504 Mouse anti-NEUN (Clone A60) MilliporeSigma Cat. No. MAB377; RRID: AB_2298772 Chicken anti-TUJ1 Aves Labs Cat. No. TUJ-0020; RRID:AB_2315518 Rabbit anti-NRF2 Abcam Cat. No. ab62352; RRID:AB_944418 Rabbit anti-cFOS Abcam Cat. No. ab214672; RRID:AB_2939046 Mouse anti-GAPDH Santa Cruz Biotechnology Cat. No. sc-47724; RRID:AB_627678 Rabbit anti-GSK3b Cell Signaling Cat. No. 12456S; RRID:AB_2636978 Rabbit anti-pS9-GSK3b Cell Signaling Cat. No. 9336S; RRID:AB_331405 anti-PSA-NCAM microbeads kit Miltenyi Biotec Cat. No. 130-092-981; RRID:AB_3674476 Chemicals, peptides, and recombinant proteins Matrigel Gibco/Thermo Fisher Scientific Cat. No. 356231 Y-27632 (Rock Inhibitor) Tocris/Biotechne Tocris Cat. No. 1254 Versene Solution (0.48 mM) Gibco/Thermo Fisher Scientific Cat. No. 15040066 StemPro Accutase Cell Dissociation Reagent Gibco/Thermo Fisher Scientific Cat. No. A1110501 GlutaMAX Supplement Gibco/Thermo Fisher Scientific Cat. No. 35050-061 MEM Non-Essential Amino Acids Gibco/Thermo Fisher Scientific Cat. No. 11140-050 N2 Supplement Gibco/Thermo Fisher Scientific Cat. No. 17502-048 Mouse Laminin Gibco/Thermo Fisher Scientific Cat. No. 23017-015 BDNF Peprotech Cat. No. 450-02B NT3 Peprotech Cat. No. 450-03B Doxycyline Takara Bio Cat. No. 631311 B27 Supplement Gibco/Thermo Fisher Scientific Cat. No. 17504-044 DMH1 Tocris/Biotechne Cat. No. 73634 SB-431542 StemCell Technologies Biotechne/Tocris No. 72234 Cat. No. 1614 Heparin StemCell Technologies No. 07980 Antibiotic-Antimycotic (100X) Gibco/ThermoFisher Cat. No. 15240062 EGF Peprotech Cat. No. AF-100-15 FGFb Peprotech Cat. No. 100-18B LDN193189 Tocris/Biotechne Cat. No. 6053 Anti-Adherence Solution StemCell Technologies Cat. No. 07010 STEMdiff Neural Rosette Selection Reagent StemCell Technologies Cat. No. 05832 FGF2 Tocris/Biotechne Cat. No. 233-FB-010 Human IL34 Peprotech Cat. No. 200-34 Human GM-CSF Peprotech Cat. No. 300-03 Human M-CSF Peprotech Cat. No. 300-25 (Continued on next page) Neuron 113, 1–18.e1–e8, March 5, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human TGFB1 Peprotech Cat. No. 100-21C TypLE express Gibco/Thermo Fisher Scientific Cat. No. 12605-028 DL-Dithiothreitol (DTT) MilliporeSigma Cat. No. D0632-1G Spermine tetrahydrochlorine MilliporeSigma Cat. No. S1141-1G Spermidine trihydrochloride MilliporeSigma Cat. No. S2501-1G protease inhibitor MilliporeSigma Cat. No. 4693159001 RNAse Inhibitor Promega Cat. No. N2615 IGEPAL CA-630 MilliporeSigma Cat. No. I8896-50ML Optiprep MilliporeSigma Cat. No. D1556-250ML TransIT -Lenti Transfection Reagent Mirus Cat. No. MIR 6606 Lentivirus Precipitation Solution Alstem Cat. No. VC100 puromycin Gibco/Thermo Fisher Scientific Cat. No. A1113803 Papain Worthington Code: PAP2; Cat. No.LK003178 Bovine Serum Albumin MilliporeSigma Cat. No. A7979 Liperfluo Dojindo Molecular Technologies Inc Cat. No. L24810 CellROX Orange ThermoFisher Scientific/Invitrogen Cat. No. C10443 Tetrodotoxin Biotechne/Tocris Cat. No. 1069 Ferrostatin Biotechne/Tocris Cat. No. 5180 Deposited data Single nucleus sequencing data from iAssembloids This study NCBI GEO: GSE272093 CROPseq data from iAssembloids This study NCBI GEO: GSE272094 Single cell sequencing data from neurons co-cultured with astrocytes, day 14 Lin et al.72 https://doi.org/10.1016/j.stemcr.2021.
Article Title: An extensive and dynamic trans-omic network illustrating prominent regulatory mechanisms in response to insulin in the liver.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Phospho-IGF-I Receptor b (Tyr1135/1136)/Insulin Receptor b (Tyr1150/1151) (19H7) Cell Signaling Technology Cat#3024S; RRID: AB_331253 Rabbit monoclonal Akt (pan) (C67E7) Cell Signaling Technology Cat#4691S; RRID: AB_915783 Rabbit monoclonal Phospho-Akt (Thr308) (C31E5E) Cell Signaling Technology Cat#2965S; RRID: AB_2255933 Rabbit monoclonal GSK-3b (D5C5Z) XP Cell Signaling Technology Cat12456S; RRID: AB_2636978 Rabbit monoclonal PhosphoGSK-3b (Ser9) (5B3) Cell Signaling Technology Cat#9323S; RRID: AB_2115201 Rabbit polyclonal insulin Rb Antibody (C-19) Santa Cruz Biotechnology Cat#sc-711; RRID: AB_631835 Biological samples MouseExpress Whole Liver Tissue (Male) L-Lysine (13C6, 97%) Cambridge Isotope Laboratories Cat#MT-LYSC6-WML Chemicals, peptides, and recombinant proteins Human insulin Sigma-Aldrich Cat#I2643 Lysyl EndopeptidaseR (Lys-C) FUJIFILM Wako Pure Chemical Corporation Cat#129-02541 Rc Trypsin (Powder) Richcore Enzymes N/A TRIzol Reagent Thermo Fisher Scientific Cat#15596018 Critical commercial assays LBIS Mouse Insulin ELISA Kit (U-type) FUJIFILM Wako Shibayagi Corporation Cat#AKRIN-031 DetectX Corticosterone ELISA Kit Arbor Assays Cat#K014-H1 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 SuperSignal West Dura Extended Duration Substrate Thermo Fisher Scientific Cat#34075 RNeasy Mini Kit QIAGEN Cat#74106 NEBNext Ultra Directional RNA Library Prep Kit for Illumina New England Biolabs Cat#E7420L NEBNext Poly(A) mRNA Magnetic Isolation Module New England Biolabs Cat#E7490L Deposited data RNA-sequencing reads and processed data This paper GEO: GSE166336 Mass spectrometry data of the proteomic analyses This paper ProteomeXchange: PXD022728 Mass spectrometry data of the phosphoproteomic analyses This paper ProteomeXchange: PXD022823 Experimental models: Organisms/Strains Mouse: C57BL6/J Charles River Laboratories Japan N/A Software and algorithms TotalLab Quant software TotalLab N/A MaxQuant Cox and Mann, 2008 https://www.maxquant.org/ Perseus Tyanova et al., 2016b https://maxquant.net/perseus/ PluginInterop Tyanova et al., 2016b https://github.com/cox-labs/PluginInterop (Continued on next page) e1 Cell Reports 36, 109569, August 24, 2021 ..
Article Title: Hypoxia-driven protease legumain promotes immunosuppression in glioblastoma
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies HIF-1a Cell Signaling Cat#14179S; RRID:AB_2622225 P-STAT6 Abcam Cat#ab28829; RRID:AB_778116 STAT6 Cell Signaling Cat#9362; RRID:AB_2271211 P-STAT3 Cell Signaling Cat#9145S; RRID:AB_2491009 STAT3 Cell Signaling Cat9139; RRID:AB_331757 GSK-3b Cell Signaling Cat12456S; RRID:AB_2636978 P-GSK-3b Cell Signaling Cat#5558S; RRID:AB_10013750 b-ACTIN Cell Signaling Cat# 3700S; RRID:AB_2242334 LGMN Cell Signaling Cat#93627S; RRID:AB_2800205 PD-L1 Cell Signaling Cat#64988S; RRID:AB_2799672 Anti-mouse IgG, HRP-Linked Cell Signaling Cat#7076S; RRID:AB_330924 Anti-rabbit IgG, HRP-linked Cell Signaling Cat#7074S; RRID:AB_2099233 Anti-rabbit IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8889S; RRID:AB_2716249 Anti-rabbit IgG, Alexa Fluor 488 Conjugate Cell Signaling Cat#4412S; RRID:AB_1904025 Anti-mouse IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8890S; RRID:AB_2714182 Anti-rat IgG, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21247; RRID:AB_141778 F4/80 Cell Signaling Cat#70076S; RRID:AB_2799771 CD206 R&D Systems Cat#AF2535; RRID:AB_2063012 Biological samples Human patient tumor samples from surgically resected IDH-WT GBMs Northwestern Central Nervous System Tissue Bank N/A Chemicals, peptides, and recombinant proteins Phorbol 12-myristate 13-acetate (PMA) Sigma–Aldrich Cat#16140071 LGMN recombinant protein BioVision Cat#7481-10 Delta-Secretase inhibitor (C11) Biosynth Cat#SIB96418 RR-11a analogue MedChemExpress Cat#HY-112205A BLZ945 Selleck Chemicals S7725 anti–PD-1 Bio X Cell Cat#BE0146 Critical commercial assays BCA protein assay kit Thermo Fisher Scientific Cat#23225 Pierce TM Magnetic ChIP Kit Thermo Fisher Scientific Cat# 26157 Proteome Profiler Human Phospho-Kinase Array Kit Bio-Techne Cat# ARY003C RNeasy Mini Kit Qiagen Cat# 74106 Deposited data ChIP–seq data Dong et al.67 GSE134974 Gene expression microarray data Chen et al.52 GEO, GSE140409 Single-cell sequencing data Darmanis et al.34 GEO, GSE84465 TCGA and CGGA expression and survival data http://gliovis.bioinfo.cnio.es/ N/A Experimental models: Cell lines 293T ATCC Cat#CRL-11268; RRID:CVCL_1926 (Continued on next page) e1 Cell Reports Medicine 4, 101238, November 21, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER QPP7 Laboratory of Dr. Jian Hu (MDACC) N/A U937 ATCC Cat#CRL-1593.2; RRID:CVCL_0007 RAW264.7 ATCC Cat#TIB-71; RRID:CVCL_0493 CT2A Seyfried et al. (68) N/A GL261 NCI-DTP Cat# Glioma 261, RRID:CVCL_Y003 THP1 ATCC Cat#TIB-202; RRID:CVCL_0006 GSC005 Laboratory of Dr. Samuel D. Rabkin (Massachusetts General Hospital) N/A Experimental models: Organisms/strains Mouse C57BL/6 Jackson Laboratory 0000664 Mouse HIF1a-flox Jackson Laboratory 007561 Mouse LyzCre Jackson Laboratory 004781 Oligonucleotides Primers for RT-qPCR This paper See STAR Methods for details LGMN primer #1(human)-F (ChIP-qPCR) This paper AGTCTCCCCTTACCCCACAG LGMN primer #1(human)-R (ChIP-qPCR) This paper CCCATCTGTGAAATCGTGAAGG LGMN primer #2(human)-F (ChIP-qPCR) This paper CGCGATTCCGTCATGCTACT LGMN primer #2(human)-R (ChIP-qPCR) This paper GTCAACTGCGGCCTGAAAAT Lgmn primer #1(mouse)-F (ChIP-qPCR) This paper ACAGCAGTAAAAAGGAATGGAGT Lgmn primer #1(mouse)-R (ChIP-qPCR) This paper TAGCACTTGGCTTCAATTGGC Lgmn primer #2(mouse)-F (ChIP-qPCR) This paper GGGCAATACTGTAAACAGCAGTAAA Lgmn primer #2(mouse)-R (ChIP-qPCR) This paper GCACTTGGCTTCAATTGGCTT Recombinant DNA psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 pLKO.1 Sigma Aldrich Cat#SHC001 pLKO.1-mouse-Lgmn shRNA #4 Sigma-Aldrich TRCN0000029256 pLKO.1-mouse-Lgmn shRNA #5 Sigma-Aldrich TRCN0000276301 pLKO.1-mouse-Hif1a shRNA #2 Sigma-Aldrich TRCN0000232221 pLKO.1-mouse-Hif1a shRNA #3 Sigma-Aldrich TRCN0000232222 Software and algorithms Prism GraphPad 9 Prism https://www.graphpad.com/ scientific-software/prism/ DESeq2 v 1.30.0 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Image Lab Bio-Rad https://www.bio-rad.com/en-us/product/ image-lab-software?ID=KRE6P5E8Z Integrative Genomics Viewer (IGV) Broad Institute http://software.broadinstitute.org/ software/igv/ Transcriptome Analysis Console Affymetrix https://www.thermofisher.com/us/en/ home/life-science/microarray-analysis/ microarray-analysis-instrumentssoftware-services/microarrayanalysis-software.html Data Visualization Tools for Brain Tumor Datasets Bowman et al.68 http://gliovis.bioinfo.cnio.es/ GSEA-4.1.0 Broad Institute http://software.broadinstitute.org/ gsea/index.jsp R package The R Project for Statistical Computing https://www.r-project.org/ ImageJ Fiji Image https://imagej.net/Fiji Cell Reports Medicine 4, 101238, November 21, 2023 e2 Article ll OPEN ACCESS Article ll OPEN ACCESS
Selection:Article Title: CRISPRi-based screens in iAssembloids to elucidate neuron-glia interactions.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD133 MicroBead Kit, human Miltenyi Biotec Cat. No. 130-097-049; RRID: AB_3674474 Neural Crest Stem Cell MicroBeads, human Miltenyi Biotec Cat. No. 130-097-127; RRID: AB_3674475 Rabbit anti-NESTIN Abcam Cat. No. ab92391; RRID:AB_10561437 Rabbit anti-SOX2 Abcam Cat. No. ab97959; RRID:AB_2341193 Mouse anti-S100b MilliporeSigma Cat. No. S2532; RRID:AB_477499 Rabbit anti-NFIA MilliporeSigma Cat. No. HPA008884; RRID:AB_1854421 Rabbit anti-IBA1 FUJIFILM Wako Cat. No. 019-19741; RRID:AB_839504 Mouse anti-NEUN (Clone A60) MilliporeSigma Cat. No. MAB377; RRID: AB_2298772 Chicken anti-TUJ1 Aves Labs Cat. No. TUJ-0020; RRID:AB_2315518 Rabbit anti-NRF2 Abcam Cat. No. ab62352; RRID:AB_944418 Rabbit anti-cFOS Abcam Cat. No. ab214672; RRID:AB_2939046 Mouse anti-GAPDH Santa Cruz Biotechnology Cat. No. sc-47724; RRID:AB_627678 Rabbit anti-GSK3b Cell Signaling Cat. No. 12456S; RRID:AB_2636978 Rabbit anti-pS9-GSK3b Cell Signaling Cat. No. 9336S; RRID:AB_331405 anti-PSA-NCAM microbeads kit Miltenyi Biotec Cat. No. 130-092-981; RRID:AB_3674476 Chemicals, peptides, and recombinant proteins Matrigel Gibco/Thermo Fisher Scientific Cat. No. 356231 Y-27632 (Rock Inhibitor) Tocris/Biotechne Tocris Cat. No. 1254 Versene Solution (0.48 mM) Gibco/Thermo Fisher Scientific Cat. No. 15040066 StemPro Accutase Cell Dissociation Reagent Gibco/Thermo Fisher Scientific Cat. No. A1110501 GlutaMAX Supplement Gibco/Thermo Fisher Scientific Cat. No. 35050-061 MEM Non-Essential Amino Acids Gibco/Thermo Fisher Scientific Cat. No. 11140-050 N2 Supplement Gibco/Thermo Fisher Scientific Cat. No. 17502-048 Mouse Laminin Gibco/Thermo Fisher Scientific Cat. No. 23017-015 BDNF Peprotech Cat. No. 450-02B NT3 Peprotech Cat. No. 450-03B Doxycyline Takara Bio Cat. No. 631311 B27 Supplement Gibco/Thermo Fisher Scientific Cat. No. 17504-044 DMH1 Tocris/Biotechne Cat. No. 73634 SB-431542 StemCell Technologies Biotechne/Tocris No. 72234 Cat. No. 1614 Heparin StemCell Technologies No. 07980 Antibiotic-Antimycotic (100X) Gibco/ThermoFisher Cat. No. 15240062 EGF Peprotech Cat. No. AF-100-15 FGFb Peprotech Cat. No. 100-18B LDN193189 Tocris/Biotechne Cat. No. 6053 Anti-Adherence Solution StemCell Technologies Cat. No. 07010 STEMdiff Neural Rosette Selection Reagent StemCell Technologies Cat. No. 05832 FGF2 Tocris/Biotechne Cat. No. 233-FB-010 Human IL34 Peprotech Cat. No. 200-34 Human GM-CSF Peprotech Cat. No. 300-03 Human M-CSF Peprotech Cat. No. 300-25 (Continued on next page) Neuron 113, 1–18.e1–e8, March 5, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human TGFB1 Peprotech Cat. No. 100-21C TypLE express Gibco/Thermo Fisher Scientific Cat. No. 12605-028 DL-Dithiothreitol (DTT) MilliporeSigma Cat. No. D0632-1G Spermine tetrahydrochlorine MilliporeSigma Cat. No. S1141-1G Spermidine trihydrochloride MilliporeSigma Cat. No. S2501-1G protease inhibitor MilliporeSigma Cat. No. 4693159001 RNAse Inhibitor Promega Cat. No. N2615 IGEPAL CA-630 MilliporeSigma Cat. No. I8896-50ML Optiprep MilliporeSigma Cat. No. D1556-250ML TransIT -Lenti Transfection Reagent Mirus Cat. No. MIR 6606 Lentivirus Precipitation Solution Alstem Cat. No. VC100 puromycin Gibco/Thermo Fisher Scientific Cat. No. A1113803 Papain Worthington Code: PAP2; Cat. No.LK003178 Bovine Serum Albumin MilliporeSigma Cat. No. A7979 Liperfluo Dojindo Molecular Technologies Inc Cat. No. L24810 CellROX Orange ThermoFisher Scientific/Invitrogen Cat. No. C10443 Tetrodotoxin Biotechne/Tocris Cat. No. 1069 Ferrostatin Biotechne/Tocris Cat. No. 5180 Deposited data Single nucleus sequencing data from iAssembloids This study NCBI GEO: GSE272093 CROPseq data from iAssembloids This study NCBI GEO: GSE272094 Single cell sequencing data from neurons co-cultured with astrocytes, day 14 Lin et al.72 https://doi.org/10.1016/j.stemcr.2021.
other:
Enzyme-linked Immunosorbent Assay:Article Title: An extensive and dynamic trans-omic network illustrating prominent regulatory mechanisms in response to insulin in the liver.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Phospho-IGF-I Receptor b (Tyr1135/1136)/Insulin Receptor b (Tyr1150/1151) (19H7) Cell Signaling Technology Cat#3024S; RRID: AB_331253 Rabbit monoclonal Akt (pan) (C67E7) Cell Signaling Technology Cat#4691S; RRID: AB_915783 Rabbit monoclonal Phospho-Akt (Thr308) (C31E5E) Cell Signaling Technology Cat#2965S; RRID: AB_2255933 Rabbit monoclonal GSK-3b (D5C5Z) XP Cell Signaling Technology Cat12456S; RRID: AB_2636978 Rabbit monoclonal PhosphoGSK-3b (Ser9) (5B3) Cell Signaling Technology Cat#9323S; RRID: AB_2115201 Rabbit polyclonal insulin Rb Antibody (C-19) Santa Cruz Biotechnology Cat#sc-711; RRID: AB_631835 Biological samples MouseExpress Whole Liver Tissue (Male) L-Lysine (13C6, 97%) Cambridge Isotope Laboratories Cat#MT-LYSC6-WML Chemicals, peptides, and recombinant proteins Human insulin Sigma-Aldrich Cat#I2643 Lysyl EndopeptidaseR (Lys-C) FUJIFILM Wako Pure Chemical Corporation Cat#129-02541 Rc Trypsin (Powder) Richcore Enzymes N/A TRIzol Reagent Thermo Fisher Scientific Cat#15596018 Critical commercial assays LBIS Mouse Insulin ELISA Kit (U-type) FUJIFILM Wako Shibayagi Corporation Cat#AKRIN-031 DetectX Corticosterone ELISA Kit Arbor Assays Cat#K014-H1 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 SuperSignal West Dura Extended Duration Substrate Thermo Fisher Scientific Cat#34075 RNeasy Mini Kit QIAGEN Cat#74106 NEBNext Ultra Directional RNA Library Prep Kit for Illumina New England Biolabs Cat#E7420L NEBNext Poly(A) mRNA Magnetic Isolation Module New England Biolabs Cat#E7490L Deposited data RNA-sequencing reads and processed data This paper GEO: GSE166336 Mass spectrometry data of the proteomic analyses This paper ProteomeXchange: PXD022728 Mass spectrometry data of the phosphoproteomic analyses This paper ProteomeXchange: PXD022823 Experimental models: Organisms/Strains Mouse: C57BL6/J Charles River Laboratories Japan N/A Software and algorithms TotalLab Quant software TotalLab N/A MaxQuant Cox and Mann, 2008 https://www.maxquant.org/ Perseus Tyanova et al., 2016b https://maxquant.net/perseus/ PluginInterop Tyanova et al., 2016b https://github.com/cox-labs/PluginInterop (Continued on next page) e1 Cell Reports 36, 109569, August 24, 2021 ..
Bicinchoninic Acid Protein Assay:Article Title: An extensive and dynamic trans-omic network illustrating prominent regulatory mechanisms in response to insulin in the liver.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Phospho-IGF-I Receptor b (Tyr1135/1136)/Insulin Receptor b (Tyr1150/1151) (19H7) Cell Signaling Technology Cat#3024S; RRID: AB_331253 Rabbit monoclonal Akt (pan) (C67E7) Cell Signaling Technology Cat#4691S; RRID: AB_915783 Rabbit monoclonal Phospho-Akt (Thr308) (C31E5E) Cell Signaling Technology Cat#2965S; RRID: AB_2255933 Rabbit monoclonal GSK-3b (D5C5Z) XP Cell Signaling Technology Cat12456S; RRID: AB_2636978 Rabbit monoclonal PhosphoGSK-3b (Ser9) (5B3) Cell Signaling Technology Cat#9323S; RRID: AB_2115201 Rabbit polyclonal insulin Rb Antibody (C-19) Santa Cruz Biotechnology Cat#sc-711; RRID: AB_631835 Biological samples MouseExpress Whole Liver Tissue (Male) L-Lysine (13C6, 97%) Cambridge Isotope Laboratories Cat#MT-LYSC6-WML Chemicals, peptides, and recombinant proteins Human insulin Sigma-Aldrich Cat#I2643 Lysyl EndopeptidaseR (Lys-C) FUJIFILM Wako Pure Chemical Corporation Cat#129-02541 Rc Trypsin (Powder) Richcore Enzymes N/A TRIzol Reagent Thermo Fisher Scientific Cat#15596018 Critical commercial assays LBIS Mouse Insulin ELISA Kit (U-type) FUJIFILM Wako Shibayagi Corporation Cat#AKRIN-031 DetectX Corticosterone ELISA Kit Arbor Assays Cat#K014-H1 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 SuperSignal West Dura Extended Duration Substrate Thermo Fisher Scientific Cat#34075 RNeasy Mini Kit QIAGEN Cat#74106 NEBNext Ultra Directional RNA Library Prep Kit for Illumina New England Biolabs Cat#E7420L NEBNext Poly(A) mRNA Magnetic Isolation Module New England Biolabs Cat#E7490L Deposited data RNA-sequencing reads and processed data This paper GEO: GSE166336 Mass spectrometry data of the proteomic analyses This paper ProteomeXchange: PXD022728 Mass spectrometry data of the phosphoproteomic analyses This paper ProteomeXchange: PXD022823 Experimental models: Organisms/Strains Mouse: C57BL6/J Charles River Laboratories Japan N/A Software and algorithms TotalLab Quant software TotalLab N/A MaxQuant Cox and Mann, 2008 https://www.maxquant.org/ Perseus Tyanova et al., 2016b https://maxquant.net/perseus/ PluginInterop Tyanova et al., 2016b https://github.com/cox-labs/PluginInterop (Continued on next page) e1 Cell Reports 36, 109569, August 24, 2021 ..
Article Title: Hypoxia-driven protease legumain promotes immunosuppression in glioblastoma
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies HIF-1a Cell Signaling Cat#14179S; RRID:AB_2622225 P-STAT6 Abcam Cat#ab28829; RRID:AB_778116 STAT6 Cell Signaling Cat#9362; RRID:AB_2271211 P-STAT3 Cell Signaling Cat#9145S; RRID:AB_2491009 STAT3 Cell Signaling Cat9139; RRID:AB_331757 GSK-3b Cell Signaling Cat12456S; RRID:AB_2636978 P-GSK-3b Cell Signaling Cat#5558S; RRID:AB_10013750 b-ACTIN Cell Signaling Cat# 3700S; RRID:AB_2242334 LGMN Cell Signaling Cat#93627S; RRID:AB_2800205 PD-L1 Cell Signaling Cat#64988S; RRID:AB_2799672 Anti-mouse IgG, HRP-Linked Cell Signaling Cat#7076S; RRID:AB_330924 Anti-rabbit IgG, HRP-linked Cell Signaling Cat#7074S; RRID:AB_2099233 Anti-rabbit IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8889S; RRID:AB_2716249 Anti-rabbit IgG, Alexa Fluor 488 Conjugate Cell Signaling Cat#4412S; RRID:AB_1904025 Anti-mouse IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8890S; RRID:AB_2714182 Anti-rat IgG, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21247; RRID:AB_141778 F4/80 Cell Signaling Cat#70076S; RRID:AB_2799771 CD206 R&D Systems Cat#AF2535; RRID:AB_2063012 Biological samples Human patient tumor samples from surgically resected IDH-WT GBMs Northwestern Central Nervous System Tissue Bank N/A Chemicals, peptides, and recombinant proteins Phorbol 12-myristate 13-acetate (PMA) Sigma–Aldrich Cat#16140071 LGMN recombinant protein BioVision Cat#7481-10 Delta-Secretase inhibitor (C11) Biosynth Cat#SIB96418 RR-11a analogue MedChemExpress Cat#HY-112205A BLZ945 Selleck Chemicals S7725 anti–PD-1 Bio X Cell Cat#BE0146 Critical commercial assays BCA protein assay kit Thermo Fisher Scientific Cat#23225 Pierce TM Magnetic ChIP Kit Thermo Fisher Scientific Cat# 26157 Proteome Profiler Human Phospho-Kinase Array Kit Bio-Techne Cat# ARY003C RNeasy Mini Kit Qiagen Cat# 74106 Deposited data ChIP–seq data Dong et al.67 GSE134974 Gene expression microarray data Chen et al.52 GEO, GSE140409 Single-cell sequencing data Darmanis et al.34 GEO, GSE84465 TCGA and CGGA expression and survival data http://gliovis.bioinfo.cnio.es/ N/A Experimental models: Cell lines 293T ATCC Cat#CRL-11268; RRID:CVCL_1926 (Continued on next page) e1 Cell Reports Medicine 4, 101238, November 21, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER QPP7 Laboratory of Dr. Jian Hu (MDACC) N/A U937 ATCC Cat#CRL-1593.2; RRID:CVCL_0007 RAW264.7 ATCC Cat#TIB-71; RRID:CVCL_0493 CT2A Seyfried et al. (68) N/A GL261 NCI-DTP Cat# Glioma 261, RRID:CVCL_Y003 THP1 ATCC Cat#TIB-202; RRID:CVCL_0006 GSC005 Laboratory of Dr. Samuel D. Rabkin (Massachusetts General Hospital) N/A Experimental models: Organisms/strains Mouse C57BL/6 Jackson Laboratory 0000664 Mouse HIF1a-flox Jackson Laboratory 007561 Mouse LyzCre Jackson Laboratory 004781 Oligonucleotides Primers for RT-qPCR This paper See STAR Methods for details LGMN primer #1(human)-F (ChIP-qPCR) This paper AGTCTCCCCTTACCCCACAG LGMN primer #1(human)-R (ChIP-qPCR) This paper CCCATCTGTGAAATCGTGAAGG LGMN primer #2(human)-F (ChIP-qPCR) This paper CGCGATTCCGTCATGCTACT LGMN primer #2(human)-R (ChIP-qPCR) This paper GTCAACTGCGGCCTGAAAAT Lgmn primer #1(mouse)-F (ChIP-qPCR) This paper ACAGCAGTAAAAAGGAATGGAGT Lgmn primer #1(mouse)-R (ChIP-qPCR) This paper TAGCACTTGGCTTCAATTGGC Lgmn primer #2(mouse)-F (ChIP-qPCR) This paper GGGCAATACTGTAAACAGCAGTAAA Lgmn primer #2(mouse)-R (ChIP-qPCR) This paper GCACTTGGCTTCAATTGGCTT Recombinant DNA psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 pLKO.1 Sigma Aldrich Cat#SHC001 pLKO.1-mouse-Lgmn shRNA #4 Sigma-Aldrich TRCN0000029256 pLKO.1-mouse-Lgmn shRNA #5 Sigma-Aldrich TRCN0000276301 pLKO.1-mouse-Hif1a shRNA #2 Sigma-Aldrich TRCN0000232221 pLKO.1-mouse-Hif1a shRNA #3 Sigma-Aldrich TRCN0000232222 Software and algorithms Prism GraphPad 9 Prism https://www.graphpad.com/ scientific-software/prism/ DESeq2 v 1.30.0 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Image Lab Bio-Rad https://www.bio-rad.com/en-us/product/ image-lab-software?ID=KRE6P5E8Z Integrative Genomics Viewer (IGV) Broad Institute http://software.broadinstitute.org/ software/igv/ Transcriptome Analysis Console Affymetrix https://www.thermofisher.com/us/en/ home/life-science/microarray-analysis/ microarray-analysis-instrumentssoftware-services/microarrayanalysis-software.html Data Visualization Tools for Brain Tumor Datasets Bowman et al.68 http://gliovis.bioinfo.cnio.es/ GSEA-4.1.0 Broad Institute http://software.broadinstitute.org/ gsea/index.jsp R package The R Project for Statistical Computing https://www.r-project.org/ ImageJ Fiji Image https://imagej.net/Fiji Cell Reports Medicine 4, 101238, November 21, 2023 e2 Article ll OPEN ACCESS Article ll OPEN ACCESS
Isolation:Article Title: An extensive and dynamic trans-omic network illustrating prominent regulatory mechanisms in response to insulin in the liver.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Phospho-IGF-I Receptor b (Tyr1135/1136)/Insulin Receptor b (Tyr1150/1151) (19H7) Cell Signaling Technology Cat#3024S; RRID: AB_331253 Rabbit monoclonal Akt (pan) (C67E7) Cell Signaling Technology Cat#4691S; RRID: AB_915783 Rabbit monoclonal Phospho-Akt (Thr308) (C31E5E) Cell Signaling Technology Cat#2965S; RRID: AB_2255933 Rabbit monoclonal GSK-3b (D5C5Z) XP Cell Signaling Technology Cat12456S; RRID: AB_2636978 Rabbit monoclonal PhosphoGSK-3b (Ser9) (5B3) Cell Signaling Technology Cat#9323S; RRID: AB_2115201 Rabbit polyclonal insulin Rb Antibody (C-19) Santa Cruz Biotechnology Cat#sc-711; RRID: AB_631835 Biological samples MouseExpress Whole Liver Tissue (Male) L-Lysine (13C6, 97%) Cambridge Isotope Laboratories Cat#MT-LYSC6-WML Chemicals, peptides, and recombinant proteins Human insulin Sigma-Aldrich Cat#I2643 Lysyl EndopeptidaseR (Lys-C) FUJIFILM Wako Pure Chemical Corporation Cat#129-02541 Rc Trypsin (Powder) Richcore Enzymes N/A TRIzol Reagent Thermo Fisher Scientific Cat#15596018 Critical commercial assays LBIS Mouse Insulin ELISA Kit (U-type) FUJIFILM Wako Shibayagi Corporation Cat#AKRIN-031 DetectX Corticosterone ELISA Kit Arbor Assays Cat#K014-H1 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 SuperSignal West Dura Extended Duration Substrate Thermo Fisher Scientific Cat#34075 RNeasy Mini Kit QIAGEN Cat#74106 NEBNext Ultra Directional RNA Library Prep Kit for Illumina New England Biolabs Cat#E7420L NEBNext Poly(A) mRNA Magnetic Isolation Module New England Biolabs Cat#E7490L Deposited data RNA-sequencing reads and processed data This paper GEO: GSE166336 Mass spectrometry data of the proteomic analyses This paper ProteomeXchange: PXD022728 Mass spectrometry data of the phosphoproteomic analyses This paper ProteomeXchange: PXD022823 Experimental models: Organisms/Strains Mouse: C57BL6/J Charles River Laboratories Japan N/A Software and algorithms TotalLab Quant software TotalLab N/A MaxQuant Cox and Mann, 2008 https://www.maxquant.org/ Perseus Tyanova et al., 2016b https://maxquant.net/perseus/ PluginInterop Tyanova et al., 2016b https://github.com/cox-labs/PluginInterop (Continued on next page) e1 Cell Reports 36, 109569, August 24, 2021 ..
RNA sequencing:Article Title: An extensive and dynamic trans-omic network illustrating prominent regulatory mechanisms in response to insulin in the liver.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Phospho-IGF-I Receptor b (Tyr1135/1136)/Insulin Receptor b (Tyr1150/1151) (19H7) Cell Signaling Technology Cat#3024S; RRID: AB_331253 Rabbit monoclonal Akt (pan) (C67E7) Cell Signaling Technology Cat#4691S; RRID: AB_915783 Rabbit monoclonal Phospho-Akt (Thr308) (C31E5E) Cell Signaling Technology Cat#2965S; RRID: AB_2255933 Rabbit monoclonal GSK-3b (D5C5Z) XP Cell Signaling Technology Cat12456S; RRID: AB_2636978 Rabbit monoclonal PhosphoGSK-3b (Ser9) (5B3) Cell Signaling Technology Cat#9323S; RRID: AB_2115201 Rabbit polyclonal insulin Rb Antibody (C-19) Santa Cruz Biotechnology Cat#sc-711; RRID: AB_631835 Biological samples MouseExpress Whole Liver Tissue (Male) L-Lysine (13C6, 97%) Cambridge Isotope Laboratories Cat#MT-LYSC6-WML Chemicals, peptides, and recombinant proteins Human insulin Sigma-Aldrich Cat#I2643 Lysyl EndopeptidaseR (Lys-C) FUJIFILM Wako Pure Chemical Corporation Cat#129-02541 Rc Trypsin (Powder) Richcore Enzymes N/A TRIzol Reagent Thermo Fisher Scientific Cat#15596018 Critical commercial assays LBIS Mouse Insulin ELISA Kit (U-type) FUJIFILM Wako Shibayagi Corporation Cat#AKRIN-031 DetectX Corticosterone ELISA Kit Arbor Assays Cat#K014-H1 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 SuperSignal West Dura Extended Duration Substrate Thermo Fisher Scientific Cat#34075 RNeasy Mini Kit QIAGEN Cat#74106 NEBNext Ultra Directional RNA Library Prep Kit for Illumina New England Biolabs Cat#E7420L NEBNext Poly(A) mRNA Magnetic Isolation Module New England Biolabs Cat#E7490L Deposited data RNA-sequencing reads and processed data This paper GEO: GSE166336 Mass spectrometry data of the proteomic analyses This paper ProteomeXchange: PXD022728 Mass spectrometry data of the phosphoproteomic analyses This paper ProteomeXchange: PXD022823 Experimental models: Organisms/Strains Mouse: C57BL6/J Charles River Laboratories Japan N/A Software and algorithms TotalLab Quant software TotalLab N/A MaxQuant Cox and Mann, 2008 https://www.maxquant.org/ Perseus Tyanova et al., 2016b https://maxquant.net/perseus/ PluginInterop Tyanova et al., 2016b https://github.com/cox-labs/PluginInterop (Continued on next page) e1 Cell Reports 36, 109569, August 24, 2021 ..
Mass Spectrometry:Article Title: An extensive and dynamic trans-omic network illustrating prominent regulatory mechanisms in response to insulin in the liver.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Phospho-IGF-I Receptor b (Tyr1135/1136)/Insulin Receptor b (Tyr1150/1151) (19H7) Cell Signaling Technology Cat#3024S; RRID: AB_331253 Rabbit monoclonal Akt (pan) (C67E7) Cell Signaling Technology Cat#4691S; RRID: AB_915783 Rabbit monoclonal Phospho-Akt (Thr308) (C31E5E) Cell Signaling Technology Cat#2965S; RRID: AB_2255933 Rabbit monoclonal GSK-3b (D5C5Z) XP Cell Signaling Technology Cat12456S; RRID: AB_2636978 Rabbit monoclonal PhosphoGSK-3b (Ser9) (5B3) Cell Signaling Technology Cat#9323S; RRID: AB_2115201 Rabbit polyclonal insulin Rb Antibody (C-19) Santa Cruz Biotechnology Cat#sc-711; RRID: AB_631835 Biological samples MouseExpress Whole Liver Tissue (Male) L-Lysine (13C6, 97%) Cambridge Isotope Laboratories Cat#MT-LYSC6-WML Chemicals, peptides, and recombinant proteins Human insulin Sigma-Aldrich Cat#I2643 Lysyl EndopeptidaseR (Lys-C) FUJIFILM Wako Pure Chemical Corporation Cat#129-02541 Rc Trypsin (Powder) Richcore Enzymes N/A TRIzol Reagent Thermo Fisher Scientific Cat#15596018 Critical commercial assays LBIS Mouse Insulin ELISA Kit (U-type) FUJIFILM Wako Shibayagi Corporation Cat#AKRIN-031 DetectX Corticosterone ELISA Kit Arbor Assays Cat#K014-H1 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 SuperSignal West Dura Extended Duration Substrate Thermo Fisher Scientific Cat#34075 RNeasy Mini Kit QIAGEN Cat#74106 NEBNext Ultra Directional RNA Library Prep Kit for Illumina New England Biolabs Cat#E7420L NEBNext Poly(A) mRNA Magnetic Isolation Module New England Biolabs Cat#E7490L Deposited data RNA-sequencing reads and processed data This paper GEO: GSE166336 Mass spectrometry data of the proteomic analyses This paper ProteomeXchange: PXD022728 Mass spectrometry data of the phosphoproteomic analyses This paper ProteomeXchange: PXD022823 Experimental models: Organisms/Strains Mouse: C57BL6/J Charles River Laboratories Japan N/A Software and algorithms TotalLab Quant software TotalLab N/A MaxQuant Cox and Mann, 2008 https://www.maxquant.org/ Perseus Tyanova et al., 2016b https://maxquant.net/perseus/ PluginInterop Tyanova et al., 2016b https://github.com/cox-labs/PluginInterop (Continued on next page) e1 Cell Reports 36, 109569, August 24, 2021 ..
Software:Article Title: An extensive and dynamic trans-omic network illustrating prominent regulatory mechanisms in response to insulin in the liver.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal Phospho-IGF-I Receptor b (Tyr1135/1136)/Insulin Receptor b (Tyr1150/1151) (19H7) Cell Signaling Technology Cat#3024S; RRID: AB_331253 Rabbit monoclonal Akt (pan) (C67E7) Cell Signaling Technology Cat#4691S; RRID: AB_915783 Rabbit monoclonal Phospho-Akt (Thr308) (C31E5E) Cell Signaling Technology Cat#2965S; RRID: AB_2255933 Rabbit monoclonal GSK-3b (D5C5Z) XP Cell Signaling Technology Cat12456S; RRID: AB_2636978 Rabbit monoclonal PhosphoGSK-3b (Ser9) (5B3) Cell Signaling Technology Cat#9323S; RRID: AB_2115201 Rabbit polyclonal insulin Rb Antibody (C-19) Santa Cruz Biotechnology Cat#sc-711; RRID: AB_631835 Biological samples MouseExpress Whole Liver Tissue (Male) L-Lysine (13C6, 97%) Cambridge Isotope Laboratories Cat#MT-LYSC6-WML Chemicals, peptides, and recombinant proteins Human insulin Sigma-Aldrich Cat#I2643 Lysyl EndopeptidaseR (Lys-C) FUJIFILM Wako Pure Chemical Corporation Cat#129-02541 Rc Trypsin (Powder) Richcore Enzymes N/A TRIzol Reagent Thermo Fisher Scientific Cat#15596018 Critical commercial assays LBIS Mouse Insulin ELISA Kit (U-type) FUJIFILM Wako Shibayagi Corporation Cat#AKRIN-031 DetectX Corticosterone ELISA Kit Arbor Assays Cat#K014-H1 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 SuperSignal West Dura Extended Duration Substrate Thermo Fisher Scientific Cat#34075 RNeasy Mini Kit QIAGEN Cat#74106 NEBNext Ultra Directional RNA Library Prep Kit for Illumina New England Biolabs Cat#E7420L NEBNext Poly(A) mRNA Magnetic Isolation Module New England Biolabs Cat#E7490L Deposited data RNA-sequencing reads and processed data This paper GEO: GSE166336 Mass spectrometry data of the proteomic analyses This paper ProteomeXchange: PXD022728 Mass spectrometry data of the phosphoproteomic analyses This paper ProteomeXchange: PXD022823 Experimental models: Organisms/Strains Mouse: C57BL6/J Charles River Laboratories Japan N/A Software and algorithms TotalLab Quant software TotalLab N/A MaxQuant Cox and Mann, 2008 https://www.maxquant.org/ Perseus Tyanova et al., 2016b https://maxquant.net/perseus/ PluginInterop Tyanova et al., 2016b https://github.com/cox-labs/PluginInterop (Continued on next page) e1 Cell Reports 36, 109569, August 24, 2021 ..
Saline:
Incubation:
Chromatin Immunoprecipitation:Article Title: Hypoxia-driven protease legumain promotes immunosuppression in glioblastoma
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies HIF-1a Cell Signaling Cat#14179S; RRID:AB_2622225 P-STAT6 Abcam Cat#ab28829; RRID:AB_778116 STAT6 Cell Signaling Cat#9362; RRID:AB_2271211 P-STAT3 Cell Signaling Cat#9145S; RRID:AB_2491009 STAT3 Cell Signaling Cat9139; RRID:AB_331757 GSK-3b Cell Signaling Cat12456S; RRID:AB_2636978 P-GSK-3b Cell Signaling Cat#5558S; RRID:AB_10013750 b-ACTIN Cell Signaling Cat# 3700S; RRID:AB_2242334 LGMN Cell Signaling Cat#93627S; RRID:AB_2800205 PD-L1 Cell Signaling Cat#64988S; RRID:AB_2799672 Anti-mouse IgG, HRP-Linked Cell Signaling Cat#7076S; RRID:AB_330924 Anti-rabbit IgG, HRP-linked Cell Signaling Cat#7074S; RRID:AB_2099233 Anti-rabbit IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8889S; RRID:AB_2716249 Anti-rabbit IgG, Alexa Fluor 488 Conjugate Cell Signaling Cat#4412S; RRID:AB_1904025 Anti-mouse IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8890S; RRID:AB_2714182 Anti-rat IgG, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21247; RRID:AB_141778 F4/80 Cell Signaling Cat#70076S; RRID:AB_2799771 CD206 R&D Systems Cat#AF2535; RRID:AB_2063012 Biological samples Human patient tumor samples from surgically resected IDH-WT GBMs Northwestern Central Nervous System Tissue Bank N/A Chemicals, peptides, and recombinant proteins Phorbol 12-myristate 13-acetate (PMA) Sigma–Aldrich Cat#16140071 LGMN recombinant protein BioVision Cat#7481-10 Delta-Secretase inhibitor (C11) Biosynth Cat#SIB96418 RR-11a analogue MedChemExpress Cat#HY-112205A BLZ945 Selleck Chemicals S7725 anti–PD-1 Bio X Cell Cat#BE0146 Critical commercial assays BCA protein assay kit Thermo Fisher Scientific Cat#23225 Pierce TM Magnetic ChIP Kit Thermo Fisher Scientific Cat# 26157 Proteome Profiler Human Phospho-Kinase Array Kit Bio-Techne Cat# ARY003C RNeasy Mini Kit Qiagen Cat# 74106 Deposited data ChIP–seq data Dong et al.67 GSE134974 Gene expression microarray data Chen et al.52 GEO, GSE140409 Single-cell sequencing data Darmanis et al.34 GEO, GSE84465 TCGA and CGGA expression and survival data http://gliovis.bioinfo.cnio.es/ N/A Experimental models: Cell lines 293T ATCC Cat#CRL-11268; RRID:CVCL_1926 (Continued on next page) e1 Cell Reports Medicine 4, 101238, November 21, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER QPP7 Laboratory of Dr. Jian Hu (MDACC) N/A U937 ATCC Cat#CRL-1593.2; RRID:CVCL_0007 RAW264.7 ATCC Cat#TIB-71; RRID:CVCL_0493 CT2A Seyfried et al. (68) N/A GL261 NCI-DTP Cat# Glioma 261, RRID:CVCL_Y003 THP1 ATCC Cat#TIB-202; RRID:CVCL_0006 GSC005 Laboratory of Dr. Samuel D. Rabkin (Massachusetts General Hospital) N/A Experimental models: Organisms/strains Mouse C57BL/6 Jackson Laboratory 0000664 Mouse HIF1a-flox Jackson Laboratory 007561 Mouse LyzCre Jackson Laboratory 004781 Oligonucleotides Primers for RT-qPCR This paper See STAR Methods for details LGMN primer #1(human)-F (ChIP-qPCR) This paper AGTCTCCCCTTACCCCACAG LGMN primer #1(human)-R (ChIP-qPCR) This paper CCCATCTGTGAAATCGTGAAGG LGMN primer #2(human)-F (ChIP-qPCR) This paper CGCGATTCCGTCATGCTACT LGMN primer #2(human)-R (ChIP-qPCR) This paper GTCAACTGCGGCCTGAAAAT Lgmn primer #1(mouse)-F (ChIP-qPCR) This paper ACAGCAGTAAAAAGGAATGGAGT Lgmn primer #1(mouse)-R (ChIP-qPCR) This paper TAGCACTTGGCTTCAATTGGC Lgmn primer #2(mouse)-F (ChIP-qPCR) This paper GGGCAATACTGTAAACAGCAGTAAA Lgmn primer #2(mouse)-R (ChIP-qPCR) This paper GCACTTGGCTTCAATTGGCTT Recombinant DNA psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 pLKO.1 Sigma Aldrich Cat#SHC001 pLKO.1-mouse-Lgmn shRNA #4 Sigma-Aldrich TRCN0000029256 pLKO.1-mouse-Lgmn shRNA #5 Sigma-Aldrich TRCN0000276301 pLKO.1-mouse-Hif1a shRNA #2 Sigma-Aldrich TRCN0000232221 pLKO.1-mouse-Hif1a shRNA #3 Sigma-Aldrich TRCN0000232222 Software and algorithms Prism GraphPad 9 Prism https://www.graphpad.com/ scientific-software/prism/ DESeq2 v 1.30.0 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Image Lab Bio-Rad https://www.bio-rad.com/en-us/product/ image-lab-software?ID=KRE6P5E8Z Integrative Genomics Viewer (IGV) Broad Institute http://software.broadinstitute.org/ software/igv/ Transcriptome Analysis Console Affymetrix https://www.thermofisher.com/us/en/ home/life-science/microarray-analysis/ microarray-analysis-instrumentssoftware-services/microarrayanalysis-software.html Data Visualization Tools for Brain Tumor Datasets Bowman et al.68 http://gliovis.bioinfo.cnio.es/ GSEA-4.1.0 Broad Institute http://software.broadinstitute.org/ gsea/index.jsp R package The R Project for Statistical Computing https://www.r-project.org/ ImageJ Fiji Image https://imagej.net/Fiji Cell Reports Medicine 4, 101238, November 21, 2023 e2 Article ll OPEN ACCESS Article ll OPEN ACCESS
Gene Expression:Article Title: Hypoxia-driven protease legumain promotes immunosuppression in glioblastoma
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies HIF-1a Cell Signaling Cat#14179S; RRID:AB_2622225 P-STAT6 Abcam Cat#ab28829; RRID:AB_778116 STAT6 Cell Signaling Cat#9362; RRID:AB_2271211 P-STAT3 Cell Signaling Cat#9145S; RRID:AB_2491009 STAT3 Cell Signaling Cat9139; RRID:AB_331757 GSK-3b Cell Signaling Cat12456S; RRID:AB_2636978 P-GSK-3b Cell Signaling Cat#5558S; RRID:AB_10013750 b-ACTIN Cell Signaling Cat# 3700S; RRID:AB_2242334 LGMN Cell Signaling Cat#93627S; RRID:AB_2800205 PD-L1 Cell Signaling Cat#64988S; RRID:AB_2799672 Anti-mouse IgG, HRP-Linked Cell Signaling Cat#7076S; RRID:AB_330924 Anti-rabbit IgG, HRP-linked Cell Signaling Cat#7074S; RRID:AB_2099233 Anti-rabbit IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8889S; RRID:AB_2716249 Anti-rabbit IgG, Alexa Fluor 488 Conjugate Cell Signaling Cat#4412S; RRID:AB_1904025 Anti-mouse IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8890S; RRID:AB_2714182 Anti-rat IgG, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21247; RRID:AB_141778 F4/80 Cell Signaling Cat#70076S; RRID:AB_2799771 CD206 R&D Systems Cat#AF2535; RRID:AB_2063012 Biological samples Human patient tumor samples from surgically resected IDH-WT GBMs Northwestern Central Nervous System Tissue Bank N/A Chemicals, peptides, and recombinant proteins Phorbol 12-myristate 13-acetate (PMA) Sigma–Aldrich Cat#16140071 LGMN recombinant protein BioVision Cat#7481-10 Delta-Secretase inhibitor (C11) Biosynth Cat#SIB96418 RR-11a analogue MedChemExpress Cat#HY-112205A BLZ945 Selleck Chemicals S7725 anti–PD-1 Bio X Cell Cat#BE0146 Critical commercial assays BCA protein assay kit Thermo Fisher Scientific Cat#23225 Pierce TM Magnetic ChIP Kit Thermo Fisher Scientific Cat# 26157 Proteome Profiler Human Phospho-Kinase Array Kit Bio-Techne Cat# ARY003C RNeasy Mini Kit Qiagen Cat# 74106 Deposited data ChIP–seq data Dong et al.67 GSE134974 Gene expression microarray data Chen et al.52 GEO, GSE140409 Single-cell sequencing data Darmanis et al.34 GEO, GSE84465 TCGA and CGGA expression and survival data http://gliovis.bioinfo.cnio.es/ N/A Experimental models: Cell lines 293T ATCC Cat#CRL-11268; RRID:CVCL_1926 (Continued on next page) e1 Cell Reports Medicine 4, 101238, November 21, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER QPP7 Laboratory of Dr. Jian Hu (MDACC) N/A U937 ATCC Cat#CRL-1593.2; RRID:CVCL_0007 RAW264.7 ATCC Cat#TIB-71; RRID:CVCL_0493 CT2A Seyfried et al. (68) N/A GL261 NCI-DTP Cat# Glioma 261, RRID:CVCL_Y003 THP1 ATCC Cat#TIB-202; RRID:CVCL_0006 GSC005 Laboratory of Dr. Samuel D. Rabkin (Massachusetts General Hospital) N/A Experimental models: Organisms/strains Mouse C57BL/6 Jackson Laboratory 0000664 Mouse HIF1a-flox Jackson Laboratory 007561 Mouse LyzCre Jackson Laboratory 004781 Oligonucleotides Primers for RT-qPCR This paper See STAR Methods for details LGMN primer #1(human)-F (ChIP-qPCR) This paper AGTCTCCCCTTACCCCACAG LGMN primer #1(human)-R (ChIP-qPCR) This paper CCCATCTGTGAAATCGTGAAGG LGMN primer #2(human)-F (ChIP-qPCR) This paper CGCGATTCCGTCATGCTACT LGMN primer #2(human)-R (ChIP-qPCR) This paper GTCAACTGCGGCCTGAAAAT Lgmn primer #1(mouse)-F (ChIP-qPCR) This paper ACAGCAGTAAAAAGGAATGGAGT Lgmn primer #1(mouse)-R (ChIP-qPCR) This paper TAGCACTTGGCTTCAATTGGC Lgmn primer #2(mouse)-F (ChIP-qPCR) This paper GGGCAATACTGTAAACAGCAGTAAA Lgmn primer #2(mouse)-R (ChIP-qPCR) This paper GCACTTGGCTTCAATTGGCTT Recombinant DNA psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 pLKO.1 Sigma Aldrich Cat#SHC001 pLKO.1-mouse-Lgmn shRNA #4 Sigma-Aldrich TRCN0000029256 pLKO.1-mouse-Lgmn shRNA #5 Sigma-Aldrich TRCN0000276301 pLKO.1-mouse-Hif1a shRNA #2 Sigma-Aldrich TRCN0000232221 pLKO.1-mouse-Hif1a shRNA #3 Sigma-Aldrich TRCN0000232222 Software and algorithms Prism GraphPad 9 Prism https://www.graphpad.com/ scientific-software/prism/ DESeq2 v 1.30.0 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Image Lab Bio-Rad https://www.bio-rad.com/en-us/product/ image-lab-software?ID=KRE6P5E8Z Integrative Genomics Viewer (IGV) Broad Institute http://software.broadinstitute.org/ software/igv/ Transcriptome Analysis Console Affymetrix https://www.thermofisher.com/us/en/ home/life-science/microarray-analysis/ microarray-analysis-instrumentssoftware-services/microarrayanalysis-software.html Data Visualization Tools for Brain Tumor Datasets Bowman et al.68 http://gliovis.bioinfo.cnio.es/ GSEA-4.1.0 Broad Institute http://software.broadinstitute.org/ gsea/index.jsp R package The R Project for Statistical Computing https://www.r-project.org/ ImageJ Fiji Image https://imagej.net/Fiji Cell Reports Medicine 4, 101238, November 21, 2023 e2 Article ll OPEN ACCESS Article ll OPEN ACCESS
Microarray:Article Title: Hypoxia-driven protease legumain promotes immunosuppression in glioblastoma
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies HIF-1a Cell Signaling Cat#14179S; RRID:AB_2622225 P-STAT6 Abcam Cat#ab28829; RRID:AB_778116 STAT6 Cell Signaling Cat#9362; RRID:AB_2271211 P-STAT3 Cell Signaling Cat#9145S; RRID:AB_2491009 STAT3 Cell Signaling Cat9139; RRID:AB_331757 GSK-3b Cell Signaling Cat12456S; RRID:AB_2636978 P-GSK-3b Cell Signaling Cat#5558S; RRID:AB_10013750 b-ACTIN Cell Signaling Cat# 3700S; RRID:AB_2242334 LGMN Cell Signaling Cat#93627S; RRID:AB_2800205 PD-L1 Cell Signaling Cat#64988S; RRID:AB_2799672 Anti-mouse IgG, HRP-Linked Cell Signaling Cat#7076S; RRID:AB_330924 Anti-rabbit IgG, HRP-linked Cell Signaling Cat#7074S; RRID:AB_2099233 Anti-rabbit IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8889S; RRID:AB_2716249 Anti-rabbit IgG, Alexa Fluor 488 Conjugate Cell Signaling Cat#4412S; RRID:AB_1904025 Anti-mouse IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8890S; RRID:AB_2714182 Anti-rat IgG, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21247; RRID:AB_141778 F4/80 Cell Signaling Cat#70076S; RRID:AB_2799771 CD206 R&D Systems Cat#AF2535; RRID:AB_2063012 Biological samples Human patient tumor samples from surgically resected IDH-WT GBMs Northwestern Central Nervous System Tissue Bank N/A Chemicals, peptides, and recombinant proteins Phorbol 12-myristate 13-acetate (PMA) Sigma–Aldrich Cat#16140071 LGMN recombinant protein BioVision Cat#7481-10 Delta-Secretase inhibitor (C11) Biosynth Cat#SIB96418 RR-11a analogue MedChemExpress Cat#HY-112205A BLZ945 Selleck Chemicals S7725 anti–PD-1 Bio X Cell Cat#BE0146 Critical commercial assays BCA protein assay kit Thermo Fisher Scientific Cat#23225 Pierce TM Magnetic ChIP Kit Thermo Fisher Scientific Cat# 26157 Proteome Profiler Human Phospho-Kinase Array Kit Bio-Techne Cat# ARY003C RNeasy Mini Kit Qiagen Cat# 74106 Deposited data ChIP–seq data Dong et al.67 GSE134974 Gene expression microarray data Chen et al.52 GEO, GSE140409 Single-cell sequencing data Darmanis et al.34 GEO, GSE84465 TCGA and CGGA expression and survival data http://gliovis.bioinfo.cnio.es/ N/A Experimental models: Cell lines 293T ATCC Cat#CRL-11268; RRID:CVCL_1926 (Continued on next page) e1 Cell Reports Medicine 4, 101238, November 21, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER QPP7 Laboratory of Dr. Jian Hu (MDACC) N/A U937 ATCC Cat#CRL-1593.2; RRID:CVCL_0007 RAW264.7 ATCC Cat#TIB-71; RRID:CVCL_0493 CT2A Seyfried et al. (68) N/A GL261 NCI-DTP Cat# Glioma 261, RRID:CVCL_Y003 THP1 ATCC Cat#TIB-202; RRID:CVCL_0006 GSC005 Laboratory of Dr. Samuel D. Rabkin (Massachusetts General Hospital) N/A Experimental models: Organisms/strains Mouse C57BL/6 Jackson Laboratory 0000664 Mouse HIF1a-flox Jackson Laboratory 007561 Mouse LyzCre Jackson Laboratory 004781 Oligonucleotides Primers for RT-qPCR This paper See STAR Methods for details LGMN primer #1(human)-F (ChIP-qPCR) This paper AGTCTCCCCTTACCCCACAG LGMN primer #1(human)-R (ChIP-qPCR) This paper CCCATCTGTGAAATCGTGAAGG LGMN primer #2(human)-F (ChIP-qPCR) This paper CGCGATTCCGTCATGCTACT LGMN primer #2(human)-R (ChIP-qPCR) This paper GTCAACTGCGGCCTGAAAAT Lgmn primer #1(mouse)-F (ChIP-qPCR) This paper ACAGCAGTAAAAAGGAATGGAGT Lgmn primer #1(mouse)-R (ChIP-qPCR) This paper TAGCACTTGGCTTCAATTGGC Lgmn primer #2(mouse)-F (ChIP-qPCR) This paper GGGCAATACTGTAAACAGCAGTAAA Lgmn primer #2(mouse)-R (ChIP-qPCR) This paper GCACTTGGCTTCAATTGGCTT Recombinant DNA psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 pLKO.1 Sigma Aldrich Cat#SHC001 pLKO.1-mouse-Lgmn shRNA #4 Sigma-Aldrich TRCN0000029256 pLKO.1-mouse-Lgmn shRNA #5 Sigma-Aldrich TRCN0000276301 pLKO.1-mouse-Hif1a shRNA #2 Sigma-Aldrich TRCN0000232221 pLKO.1-mouse-Hif1a shRNA #3 Sigma-Aldrich TRCN0000232222 Software and algorithms Prism GraphPad 9 Prism https://www.graphpad.com/ scientific-software/prism/ DESeq2 v 1.30.0 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Image Lab Bio-Rad https://www.bio-rad.com/en-us/product/ image-lab-software?ID=KRE6P5E8Z Integrative Genomics Viewer (IGV) Broad Institute http://software.broadinstitute.org/ software/igv/ Transcriptome Analysis Console Affymetrix https://www.thermofisher.com/us/en/ home/life-science/microarray-analysis/ microarray-analysis-instrumentssoftware-services/microarrayanalysis-software.html Data Visualization Tools for Brain Tumor Datasets Bowman et al.68 http://gliovis.bioinfo.cnio.es/ GSEA-4.1.0 Broad Institute http://software.broadinstitute.org/ gsea/index.jsp R package The R Project for Statistical Computing https://www.r-project.org/ ImageJ Fiji Image https://imagej.net/Fiji Cell Reports Medicine 4, 101238, November 21, 2023 e2 Article ll OPEN ACCESS Article ll OPEN ACCESS
Single Cell:Article Title: Hypoxia-driven protease legumain promotes immunosuppression in glioblastoma
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies HIF-1a Cell Signaling Cat#14179S; RRID:AB_2622225 P-STAT6 Abcam Cat#ab28829; RRID:AB_778116 STAT6 Cell Signaling Cat#9362; RRID:AB_2271211 P-STAT3 Cell Signaling Cat#9145S; RRID:AB_2491009 STAT3 Cell Signaling Cat9139; RRID:AB_331757 GSK-3b Cell Signaling Cat12456S; RRID:AB_2636978 P-GSK-3b Cell Signaling Cat#5558S; RRID:AB_10013750 b-ACTIN Cell Signaling Cat# 3700S; RRID:AB_2242334 LGMN Cell Signaling Cat#93627S; RRID:AB_2800205 PD-L1 Cell Signaling Cat#64988S; RRID:AB_2799672 Anti-mouse IgG, HRP-Linked Cell Signaling Cat#7076S; RRID:AB_330924 Anti-rabbit IgG, HRP-linked Cell Signaling Cat#7074S; RRID:AB_2099233 Anti-rabbit IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8889S; RRID:AB_2716249 Anti-rabbit IgG, Alexa Fluor 488 Conjugate Cell Signaling Cat#4412S; RRID:AB_1904025 Anti-mouse IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8890S; RRID:AB_2714182 Anti-rat IgG, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21247; RRID:AB_141778 F4/80 Cell Signaling Cat#70076S; RRID:AB_2799771 CD206 R&D Systems Cat#AF2535; RRID:AB_2063012 Biological samples Human patient tumor samples from surgically resected IDH-WT GBMs Northwestern Central Nervous System Tissue Bank N/A Chemicals, peptides, and recombinant proteins Phorbol 12-myristate 13-acetate (PMA) Sigma–Aldrich Cat#16140071 LGMN recombinant protein BioVision Cat#7481-10 Delta-Secretase inhibitor (C11) Biosynth Cat#SIB96418 RR-11a analogue MedChemExpress Cat#HY-112205A BLZ945 Selleck Chemicals S7725 anti–PD-1 Bio X Cell Cat#BE0146 Critical commercial assays BCA protein assay kit Thermo Fisher Scientific Cat#23225 Pierce TM Magnetic ChIP Kit Thermo Fisher Scientific Cat# 26157 Proteome Profiler Human Phospho-Kinase Array Kit Bio-Techne Cat# ARY003C RNeasy Mini Kit Qiagen Cat# 74106 Deposited data ChIP–seq data Dong et al.67 GSE134974 Gene expression microarray data Chen et al.52 GEO, GSE140409 Single-cell sequencing data Darmanis et al.34 GEO, GSE84465 TCGA and CGGA expression and survival data http://gliovis.bioinfo.cnio.es/ N/A Experimental models: Cell lines 293T ATCC Cat#CRL-11268; RRID:CVCL_1926 (Continued on next page) e1 Cell Reports Medicine 4, 101238, November 21, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER QPP7 Laboratory of Dr. Jian Hu (MDACC) N/A U937 ATCC Cat#CRL-1593.2; RRID:CVCL_0007 RAW264.7 ATCC Cat#TIB-71; RRID:CVCL_0493 CT2A Seyfried et al. (68) N/A GL261 NCI-DTP Cat# Glioma 261, RRID:CVCL_Y003 THP1 ATCC Cat#TIB-202; RRID:CVCL_0006 GSC005 Laboratory of Dr. Samuel D. Rabkin (Massachusetts General Hospital) N/A Experimental models: Organisms/strains Mouse C57BL/6 Jackson Laboratory 0000664 Mouse HIF1a-flox Jackson Laboratory 007561 Mouse LyzCre Jackson Laboratory 004781 Oligonucleotides Primers for RT-qPCR This paper See STAR Methods for details LGMN primer #1(human)-F (ChIP-qPCR) This paper AGTCTCCCCTTACCCCACAG LGMN primer #1(human)-R (ChIP-qPCR) This paper CCCATCTGTGAAATCGTGAAGG LGMN primer #2(human)-F (ChIP-qPCR) This paper CGCGATTCCGTCATGCTACT LGMN primer #2(human)-R (ChIP-qPCR) This paper GTCAACTGCGGCCTGAAAAT Lgmn primer #1(mouse)-F (ChIP-qPCR) This paper ACAGCAGTAAAAAGGAATGGAGT Lgmn primer #1(mouse)-R (ChIP-qPCR) This paper TAGCACTTGGCTTCAATTGGC Lgmn primer #2(mouse)-F (ChIP-qPCR) This paper GGGCAATACTGTAAACAGCAGTAAA Lgmn primer #2(mouse)-R (ChIP-qPCR) This paper GCACTTGGCTTCAATTGGCTT Recombinant DNA psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 pLKO.1 Sigma Aldrich Cat#SHC001 pLKO.1-mouse-Lgmn shRNA #4 Sigma-Aldrich TRCN0000029256 pLKO.1-mouse-Lgmn shRNA #5 Sigma-Aldrich TRCN0000276301 pLKO.1-mouse-Hif1a shRNA #2 Sigma-Aldrich TRCN0000232221 pLKO.1-mouse-Hif1a shRNA #3 Sigma-Aldrich TRCN0000232222 Software and algorithms Prism GraphPad 9 Prism https://www.graphpad.com/ scientific-software/prism/ DESeq2 v 1.30.0 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Image Lab Bio-Rad https://www.bio-rad.com/en-us/product/ image-lab-software?ID=KRE6P5E8Z Integrative Genomics Viewer (IGV) Broad Institute http://software.broadinstitute.org/ software/igv/ Transcriptome Analysis Console Affymetrix https://www.thermofisher.com/us/en/ home/life-science/microarray-analysis/ microarray-analysis-instrumentssoftware-services/microarrayanalysis-software.html Data Visualization Tools for Brain Tumor Datasets Bowman et al.68 http://gliovis.bioinfo.cnio.es/ GSEA-4.1.0 Broad Institute http://software.broadinstitute.org/ gsea/index.jsp R package The R Project for Statistical Computing https://www.r-project.org/ ImageJ Fiji Image https://imagej.net/Fiji Cell Reports Medicine 4, 101238, November 21, 2023 e2 Article ll OPEN ACCESS Article ll OPEN ACCESS
Sequencing:Article Title: Hypoxia-driven protease legumain promotes immunosuppression in glioblastoma
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies HIF-1a Cell Signaling Cat#14179S; RRID:AB_2622225 P-STAT6 Abcam Cat#ab28829; RRID:AB_778116 STAT6 Cell Signaling Cat#9362; RRID:AB_2271211 P-STAT3 Cell Signaling Cat#9145S; RRID:AB_2491009 STAT3 Cell Signaling Cat9139; RRID:AB_331757 GSK-3b Cell Signaling Cat12456S; RRID:AB_2636978 P-GSK-3b Cell Signaling Cat#5558S; RRID:AB_10013750 b-ACTIN Cell Signaling Cat# 3700S; RRID:AB_2242334 LGMN Cell Signaling Cat#93627S; RRID:AB_2800205 PD-L1 Cell Signaling Cat#64988S; RRID:AB_2799672 Anti-mouse IgG, HRP-Linked Cell Signaling Cat#7076S; RRID:AB_330924 Anti-rabbit IgG, HRP-linked Cell Signaling Cat#7074S; RRID:AB_2099233 Anti-rabbit IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8889S; RRID:AB_2716249 Anti-rabbit IgG, Alexa Fluor 488 Conjugate Cell Signaling Cat#4412S; RRID:AB_1904025 Anti-mouse IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8890S; RRID:AB_2714182 Anti-rat IgG, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21247; RRID:AB_141778 F4/80 Cell Signaling Cat#70076S; RRID:AB_2799771 CD206 R&D Systems Cat#AF2535; RRID:AB_2063012 Biological samples Human patient tumor samples from surgically resected IDH-WT GBMs Northwestern Central Nervous System Tissue Bank N/A Chemicals, peptides, and recombinant proteins Phorbol 12-myristate 13-acetate (PMA) Sigma–Aldrich Cat#16140071 LGMN recombinant protein BioVision Cat#7481-10 Delta-Secretase inhibitor (C11) Biosynth Cat#SIB96418 RR-11a analogue MedChemExpress Cat#HY-112205A BLZ945 Selleck Chemicals S7725 anti–PD-1 Bio X Cell Cat#BE0146 Critical commercial assays BCA protein assay kit Thermo Fisher Scientific Cat#23225 Pierce TM Magnetic ChIP Kit Thermo Fisher Scientific Cat# 26157 Proteome Profiler Human Phospho-Kinase Array Kit Bio-Techne Cat# ARY003C RNeasy Mini Kit Qiagen Cat# 74106 Deposited data ChIP–seq data Dong et al.67 GSE134974 Gene expression microarray data Chen et al.52 GEO, GSE140409 Single-cell sequencing data Darmanis et al.34 GEO, GSE84465 TCGA and CGGA expression and survival data http://gliovis.bioinfo.cnio.es/ N/A Experimental models: Cell lines 293T ATCC Cat#CRL-11268; RRID:CVCL_1926 (Continued on next page) e1 Cell Reports Medicine 4, 101238, November 21, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER QPP7 Laboratory of Dr. Jian Hu (MDACC) N/A U937 ATCC Cat#CRL-1593.2; RRID:CVCL_0007 RAW264.7 ATCC Cat#TIB-71; RRID:CVCL_0493 CT2A Seyfried et al. (68) N/A GL261 NCI-DTP Cat# Glioma 261, RRID:CVCL_Y003 THP1 ATCC Cat#TIB-202; RRID:CVCL_0006 GSC005 Laboratory of Dr. Samuel D. Rabkin (Massachusetts General Hospital) N/A Experimental models: Organisms/strains Mouse C57BL/6 Jackson Laboratory 0000664 Mouse HIF1a-flox Jackson Laboratory 007561 Mouse LyzCre Jackson Laboratory 004781 Oligonucleotides Primers for RT-qPCR This paper See STAR Methods for details LGMN primer #1(human)-F (ChIP-qPCR) This paper AGTCTCCCCTTACCCCACAG LGMN primer #1(human)-R (ChIP-qPCR) This paper CCCATCTGTGAAATCGTGAAGG LGMN primer #2(human)-F (ChIP-qPCR) This paper CGCGATTCCGTCATGCTACT LGMN primer #2(human)-R (ChIP-qPCR) This paper GTCAACTGCGGCCTGAAAAT Lgmn primer #1(mouse)-F (ChIP-qPCR) This paper ACAGCAGTAAAAAGGAATGGAGT Lgmn primer #1(mouse)-R (ChIP-qPCR) This paper TAGCACTTGGCTTCAATTGGC Lgmn primer #2(mouse)-F (ChIP-qPCR) This paper GGGCAATACTGTAAACAGCAGTAAA Lgmn primer #2(mouse)-R (ChIP-qPCR) This paper GCACTTGGCTTCAATTGGCTT Recombinant DNA psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 pLKO.1 Sigma Aldrich Cat#SHC001 pLKO.1-mouse-Lgmn shRNA #4 Sigma-Aldrich TRCN0000029256 pLKO.1-mouse-Lgmn shRNA #5 Sigma-Aldrich TRCN0000276301 pLKO.1-mouse-Hif1a shRNA #2 Sigma-Aldrich TRCN0000232221 pLKO.1-mouse-Hif1a shRNA #3 Sigma-Aldrich TRCN0000232222 Software and algorithms Prism GraphPad 9 Prism https://www.graphpad.com/ scientific-software/prism/ DESeq2 v 1.30.0 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Image Lab Bio-Rad https://www.bio-rad.com/en-us/product/ image-lab-software?ID=KRE6P5E8Z Integrative Genomics Viewer (IGV) Broad Institute http://software.broadinstitute.org/ software/igv/ Transcriptome Analysis Console Affymetrix https://www.thermofisher.com/us/en/ home/life-science/microarray-analysis/ microarray-analysis-instrumentssoftware-services/microarrayanalysis-software.html Data Visualization Tools for Brain Tumor Datasets Bowman et al.68 http://gliovis.bioinfo.cnio.es/ GSEA-4.1.0 Broad Institute http://software.broadinstitute.org/ gsea/index.jsp R package The R Project for Statistical Computing https://www.r-project.org/ ImageJ Fiji Image https://imagej.net/Fiji Cell Reports Medicine 4, 101238, November 21, 2023 e2 Article ll OPEN ACCESS Article ll OPEN ACCESS
Expressing:Article Title: Hypoxia-driven protease legumain promotes immunosuppression in glioblastoma
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies HIF-1a Cell Signaling Cat#14179S; RRID:AB_2622225 P-STAT6 Abcam Cat#ab28829; RRID:AB_778116 STAT6 Cell Signaling Cat#9362; RRID:AB_2271211 P-STAT3 Cell Signaling Cat#9145S; RRID:AB_2491009 STAT3 Cell Signaling Cat9139; RRID:AB_331757 GSK-3b Cell Signaling Cat12456S; RRID:AB_2636978 P-GSK-3b Cell Signaling Cat#5558S; RRID:AB_10013750 b-ACTIN Cell Signaling Cat# 3700S; RRID:AB_2242334 LGMN Cell Signaling Cat#93627S; RRID:AB_2800205 PD-L1 Cell Signaling Cat#64988S; RRID:AB_2799672 Anti-mouse IgG, HRP-Linked Cell Signaling Cat#7076S; RRID:AB_330924 Anti-rabbit IgG, HRP-linked Cell Signaling Cat#7074S; RRID:AB_2099233 Anti-rabbit IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8889S; RRID:AB_2716249 Anti-rabbit IgG, Alexa Fluor 488 Conjugate Cell Signaling Cat#4412S; RRID:AB_1904025 Anti-mouse IgG, Alexa Fluor 594 Conjugate Cell Signaling Cat#8890S; RRID:AB_2714182 Anti-rat IgG, Alexa Fluor 647 Thermo Fisher Scientific Cat#A-21247; RRID:AB_141778 F4/80 Cell Signaling Cat#70076S; RRID:AB_2799771 CD206 R&D Systems Cat#AF2535; RRID:AB_2063012 Biological samples Human patient tumor samples from surgically resected IDH-WT GBMs Northwestern Central Nervous System Tissue Bank N/A Chemicals, peptides, and recombinant proteins Phorbol 12-myristate 13-acetate (PMA) Sigma–Aldrich Cat#16140071 LGMN recombinant protein BioVision Cat#7481-10 Delta-Secretase inhibitor (C11) Biosynth Cat#SIB96418 RR-11a analogue MedChemExpress Cat#HY-112205A BLZ945 Selleck Chemicals S7725 anti–PD-1 Bio X Cell Cat#BE0146 Critical commercial assays BCA protein assay kit Thermo Fisher Scientific Cat#23225 Pierce TM Magnetic ChIP Kit Thermo Fisher Scientific Cat# 26157 Proteome Profiler Human Phospho-Kinase Array Kit Bio-Techne Cat# ARY003C RNeasy Mini Kit Qiagen Cat# 74106 Deposited data ChIP–seq data Dong et al.67 GSE134974 Gene expression microarray data Chen et al.52 GEO, GSE140409 Single-cell sequencing data Darmanis et al.34 GEO, GSE84465 TCGA and CGGA expression and survival data http://gliovis.bioinfo.cnio.es/ N/A Experimental models: Cell lines 293T ATCC Cat#CRL-11268; RRID:CVCL_1926 (Continued on next page) e1 Cell Reports Medicine 4, 101238, November 21, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER QPP7 Laboratory of Dr. Jian Hu (MDACC) N/A U937 ATCC Cat#CRL-1593.2; RRID:CVCL_0007 RAW264.7 ATCC Cat#TIB-71; RRID:CVCL_0493 CT2A Seyfried et al. (68) N/A GL261 NCI-DTP Cat# Glioma 261, RRID:CVCL_Y003 THP1 ATCC Cat#TIB-202; RRID:CVCL_0006 GSC005 Laboratory of Dr. Samuel D. Rabkin (Massachusetts General Hospital) N/A Experimental models: Organisms/strains Mouse C57BL/6 Jackson Laboratory 0000664 Mouse HIF1a-flox Jackson Laboratory 007561 Mouse LyzCre Jackson Laboratory 004781 Oligonucleotides Primers for RT-qPCR This paper See STAR Methods for details LGMN primer #1(human)-F (ChIP-qPCR) This paper AGTCTCCCCTTACCCCACAG LGMN primer #1(human)-R (ChIP-qPCR) This paper CCCATCTGTGAAATCGTGAAGG LGMN primer #2(human)-F (ChIP-qPCR) This paper CGCGATTCCGTCATGCTACT LGMN primer #2(human)-R (ChIP-qPCR) This paper GTCAACTGCGGCCTGAAAAT Lgmn primer #1(mouse)-F (ChIP-qPCR) This paper ACAGCAGTAAAAAGGAATGGAGT Lgmn primer #1(mouse)-R (ChIP-qPCR) This paper TAGCACTTGGCTTCAATTGGC Lgmn primer #2(mouse)-F (ChIP-qPCR) This paper GGGCAATACTGTAAACAGCAGTAAA Lgmn primer #2(mouse)-R (ChIP-qPCR) This paper GCACTTGGCTTCAATTGGCTT Recombinant DNA psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 pLKO.1 Sigma Aldrich Cat#SHC001 pLKO.1-mouse-Lgmn shRNA #4 Sigma-Aldrich TRCN0000029256 pLKO.1-mouse-Lgmn shRNA #5 Sigma-Aldrich TRCN0000276301 pLKO.1-mouse-Hif1a shRNA #2 Sigma-Aldrich TRCN0000232221 pLKO.1-mouse-Hif1a shRNA #3 Sigma-Aldrich TRCN0000232222 Software and algorithms Prism GraphPad 9 Prism https://www.graphpad.com/ scientific-software/prism/ DESeq2 v 1.30.0 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html Image Lab Bio-Rad https://www.bio-rad.com/en-us/product/ image-lab-software?ID=KRE6P5E8Z Integrative Genomics Viewer (IGV) Broad Institute http://software.broadinstitute.org/ software/igv/ Transcriptome Analysis Console Affymetrix https://www.thermofisher.com/us/en/ home/life-science/microarray-analysis/ microarray-analysis-instrumentssoftware-services/microarrayanalysis-software.html Data Visualization Tools for Brain Tumor Datasets Bowman et al.68 http://gliovis.bioinfo.cnio.es/ GSEA-4.1.0 Broad Institute http://software.broadinstitute.org/ gsea/index.jsp R package The R Project for Statistical Computing https://www.r-project.org/ ImageJ Fiji Image https://imagej.net/Fiji Cell Reports Medicine 4, 101238, November 21, 2023 e2 Article ll OPEN ACCESS Article ll OPEN ACCESS
|
Cell Signaling Technology Inc is a verified supplier 
Cell Signaling Technology Inc manufactures this product 
